Some general guidelines on the primer design for PCR cloning:-
  1. Complementary sequence of 18-22 bases is sufficient in most cases if you don't bother to calculate Tm and other parameters (see links below if you want to calculate Tm etc.).
  2. If your protein is not fused to anything, you should add a start codon (ATG) immediately in front of your gene in the forward primer, and the complement of a stop codon (TAA/TGA/TAG - TAA is preferred) immediately after in your reverse primer.
  3. Introduce one or more restriction sites depending on how you wish to ligate the gene into the expression vector - e.g. if you use pET 21b, use NdeI (conveniently containing the start codon) for the forward primer, and XhoI for the reverse primer if you wish to fuse the protein to a C-terminal His-tag.
  4. Put in extra bases at the 5'end to allow for efficient digest by restriction enzymes - consult NEB catalog . 8-10 are more than sufficient in most if not all cases (it's actually a bit of overkill as 3-4 are suitable for most). These extra bases are unnecessary if you are doing TA cloning.
  5. Some of these extra bases can form a G/C clamp at the 5'end.
  6. Avoid too many G or C at the 3'end.
  7. Avoid long runs of single nucleotide.
  8. Make sure the forward and reverse primer don't form primer dimer (esp. no complementary sequences at the 3' end) or form significant secondary structure. See Alkami Biosystem Primer Design online for primer design sites which may help.
  9. It may be useful (though normally unnecessary) to check sequences of gene or vector for homology of 70% or more with the primer to avoid multiple PCR products.
The above guidelines should be sufficient in most cases, but if you'd like more details, see tips on primer design , notes on primer design, and at Tavi's PCR guide. There are also a number of web-sites for primer design at Alkami Biosystems and at BioGuide.

Example

N can be any of the 4 nucleotides, therefore
Forward oligo
5' GGCGCAATACATATGAGAGACAGTGGGACCGTCTG 3'
Reverse oligo
5' GGCCGAACTCGAGTTACTCTAGAATCCTCAAGTCCA 3'
(sequence complement to the sense strand)

Note:
1) If the N-terminus of your protein is not fused to any fusion partner or peptide, it is often useful to change wherever possible G or C to A or T for the first few codon. This will help reduce secondary structure on the translation initiation site and therefore improve expression.
2) Although we need not consider designing degenerate primer, but should the need arise, see degenerate PCR for guidance.
3)



Back to rough guide
Last modified: Mon Apr 10 18:59:08 BST 2000
chen@biochem.ucl.ac.uk